Ferguson, Neil

a British epidemiologist and professor of mathematical biology, and the head of the Dep’t of Infectious Disease Epidemiology at Imperial College London. He specializes in creating inaccurate and overestimated computer models of infectious diseases to create pandemic fear and is funded by the Bill and Melinda Gates Foundation. Ferguson’s COVID-19 model predicted that 500,000 COVID deaths in the UK and 2 million in the US would occur by the summer of 2020. This absurd and criminal estimate directly influenced Boris Johnson and Donald Trump to declare states of emergency, and abandon plans to keep their national economies open. Then Ferguson violated his own lockdown recommendations by carrying on an affair with his mistress, who lived in her separate home with her husband.

According to the Business Insider (4/25) [6], “Ferguson’s team warned Boris Johnson that the quest for ‘herd immunity’ [letting people live their lives out in the open in the UK] could cost 510,000 lives, prompting an abrupt U-turn [massive national lockdown in the UK]…His simulations have been influential in other countries as well, cited by authorities in the US, Germany, and France.”

Not only cited, not only influential, but swallowed whole.

Business insider continues: “On March 23, the UK scrapped ‘herd immunity’ in favor of a suppression strategy, and the country made preparations for weeks of lockdown. Ferguson’s study was responsible.”

There’s more. A lot more.

Same BI article: “Dr Deborah Birx, coronavirus response coordinator to the Trump administration, told journalists at a March 16 press briefing that the Imperial paper [Ferguson’s computer projection] prompted the CDC’s new advice to work from home and avoid gatherings of 10 or more.”

Ferguson, instigator of LOCKDOWN. Stripping away of basic liberties. Economic devastation.

So let’s look at Ferguson’s track record, spelled out in the BI piece:

Ferguson co-founded the MRC Centre for Global Infectious Disease Analysis, based at Imperial, in 2008. It is the leading body advising national governments on pathogen outbreaks.

It gets tens of millions of dollars in annual funding from the Bill & Melinda Gates Foundation, and works with the UK National Health Service, the US Centres for Disease Prevention and Control (CDC), and is tasked with supplying the World Health Organization with ‘rapid analysis of urgent infectious disease problems’.

Getting the picture?

Gates money goes to Ferguson.

Ferguson predicts dire threat from COVID, necessitating lockdowns—thus preparing people to accept a vaccine. The vaccine Gates wants.

Ferguson supplies a frightening computer projection of COVID deaths—to the CDC and WHO. Ferguson thus communicates a rationale for the Gates vaccine plan.

National governments surrender to WHO and CDC. LOCKDOWNS.

Business Insider:

Michael Thrusfield, a professor of veterinary epidemiology at Edinburgh University, told the paper he had ‘déjà vu’ after reading the [Ferguson] Imperial paper [on COVID], saying Ferguson was responsible for excessive animal culling during the 2001 Foot and Mouth [mad cow] outbreak.

Ferguson warned the government that 150,000 people could die. Six million animals were slaughtered as a precaution, costing the country billions in farming revenue. In the end, 200 people died.

Similarly, he [Ferguson] was accused of creating panic by overestimating the potential death toll during the 2005 Bird Flu outbreak. Ferguson estimated 200 million could die. The real number was in the low hundreds.

In 2009, one of Ferguson’s models predicted 65,000 people could die from the Swine Flu outbreak in the UK — the final figure was below 500.

So you have to ask yourself, why would anyone believe what Ferguson has been predicting in this COVID hustle?

Are his fellow experts that stupid?

Are presidents and prime ministers that stupid?

And the answer is: This is a monumental covert op; some people are that stupid; some are caught up in the op and are afraid to say the emperor has no clothes; some are aware of what is going on, and they want to destroy national economies and lead us into, yes, a new world order.

Gates knows he has his man: Ferguson. As the recipient of tens of millions of dollars a year from the Gates Foundation, Ferguson isn’t about to issue a model that states: COVID is nothing to worry about, let people live their lives and we’ll be all right. The chance of that happening is on a par with researchers admitting they never properly identified a new virus as the cause of illness in 2019, in Wuhan. [7]

In order to justify injecting every man, woman, and child in the world with heavy metals, synthetic genes that alter genetic makeup, a host of germs, and who knows what else, Gates needs A STORY ABOUT A DEADLY VIRUS THAT NECESSITATES SHUTTING DOWN AND IMPRISONING THE PLANET, ACHIEVING A CAPTIVE AUDIENCE.

He’s got the story, all dressed up in a computer model, composed by a man with a past record of abject and devastating failures.

Neil Ferguson is the ghost in the machine. The machine is the World Health Organization and the CDC. The man behind the ghost is Bill Gates.

In December 2020 he was back, on television, warning citizens about a new “mutant strain” of the virus and the need for a higher level of lockdown. Claiming a new “mutant strain” of SARS-CoV-2 is 70% more deadly than the original, computer modelers in the UK advised Prime Minister, Boris Johnson, to lock down the country at a much stricter level.

The computer model was concocted at the Imperial College of London. The accompanying text actually admits it’s too early to tell whether the mutant strain is a major threat. Nevertheless, Boris Johnson issued the new vast lockdown order. He didn’t author the new model/study at the Imperial College, but he’s now the face of the “science.” Other scientists are outraged at the latest computer model; they are demanding to see the actual evidence of the increased threat. They’re saying they don’t even understand what “70% more deadly than the original strain” means.

Source: https://blog.nomorefakenews.com/2020/12/24/neil-ferguson-playing-key-role-in-new-lockdowns/

Carbon Dating

Radiation from the sun strikes the atmosphere of the earth all day long. This energy converts about 21 pounds of nitrogen into radioactive carbon 14. This radioactive carbon 14 slowly decays back into normal, stable nitrogen. Extensive laboratory testing has shown that about half of the C-14 molecules will decay in 5,730 years. This is called the half-life. After another 5,730 years half of the remaining C-14 will decay leaving only 1⁄4 of the original C-14. It goes from 1⁄2 to 1⁄4 to 1⁄8, etc. In theory it would never totally disappear, but after about 5 half-lives the difference is not measurable with any degree of accuracy. This is why most people say carbon dating is only good for objects less than 40,000 years old. Nothing on earth carbon dates in the millions of years, because the scope of carbon dating only extends a few thousand years. Willard Libby invented the carbon dating technique in the early 1950s. The amount of carbon 14 in the atmosphere today is about .0000765%. It is assumed there would be the same amount found in living plants or animals since the plants breath CO₂ and animals eat the plants.

Since sunlight causes the formation of C-14 in the atmosphere, and normal radioactive decay takes it out, there must be a point where the formation rate and the decay rate equalizes. This is called the point of equilibrium. To illustrate: If you were trying to fill a barrel with water but there were holes drilled up the side of the barrel, as you filled the barrel it would begin leaking out the holes. At some point you would be putting it in and it would be leaking out at the same rate. You will not be able to fill the barrel past this point of equilibrium. In the same way the C-14 is being formed and decaying simultaneously. A freshly created earth would require about 30,000 years for the amount of C-14 in the atmosphere to reach this point of equilibrium because it would leak out as it is being filled. Tests indicate that the earth has still not reached equilibrium. There is more C-14 in the atmosphere now than there was 40 years ago. This would prove the earth is not yet 30,000 years old! This also means that plants and animals that lived in the past had less C-14 in them than do plants and animals today. Just this one fact totally upsets data obtained by C-14 dating.

The carbon in the atmosphere normally combines with oxygen to make carbon dioxide (CO₂). Plants breathe CO₂ and make it part of their tissue. Animals eat the plants and make it part of their tissues. A very small percentage of the carbon plants take in is radioactive C-14. When a plant or animal dies, it stops taking in air and food so it should not be able to get any new C-14. The C-14 in the plant or animal will begin to decay back to normal nitrogen. The older an object is, the less carbon 14 it contains. One gram of carbon from living plant material causes a Geiger counter to click 16 times per minute as the C-14 decays. A sample that causes 8 clicks per minute would be 5,730 years old (the sample has gone through one half-life) and so on.

The conclusion by many scientists and others who are aware of this information is that radiometric dating methods are nothing more than guesses based on highly speculative theories rather than on facts.

The Assumptions of Carbon Dating

Although this technique looks good at first, carbon-14 dating rests on at least two simple assumptions. These are, obviously, the assumption that the amount of carbon 14 in the atmosphere has always been constant and that its rate of decay has always been constant. Neither of these assumptions is provable or reasonable. An illustration may help: Imagine you found a candle burning in a room, and you wanted to determine how long it was burning before you found it. You could measure the present height of the candle (say, 7 inches) and the rate of burn (say, an inch per hour). In order to find the length of time since the candle was lit, we would be forced to make some assumptions. We would, obviously, have to assume that the candle has always burned at the same rate, and assume an initial height of the candle. The answer changes based on the assumptions. Similarly, scientists do not know that the carbon-14 decay rate has been constant. They do not know that the amount of carbon 14 in the atmosphere is constant. Present testing shows the amount of C-14 in the atmosphere has been increasing since it was first measured in the 1950s. This may be tied in to the declining strength of the magnetic field.

In addition to the above assumptions, dating methods are all subject to the geologic column date to verify their accuracy. If a date obtained by radiometric dating does not match the assumed age from the geologic column, the radiometric date will be rejected. The so-called geologic column was developed in the early 1800s over a century before there were any radio- metric dating methods. “Apart from very ‘modern’ examples, which are really archaeology, I can think of no cases of radioactive decay being used to date fossils.”1 Laboratories will not carbon date dinosaur bones (even frozen ones which could easily be carbon dated) because dinosaurs are supposed to have lived 70 million years ago according to the fictitious geologic column. An object’s supposed place on the geologic column determines the method used to date it. There are about 7 or 8 radioactive elements that are used today to try to date objects. Each one has a different half-life and a different range of ages it is supposed to be used for. No dating method cited by evolutionists is unbiased.2

The two assumptions that plague C-14 dating were discussed by Sylvia Baker 10 with regard to why “dates” of more than 6,000 years are often obtained by this method.

“Many … objections cast doubt on the reliability of this method.  We shall consider just two of them.

  1. The theory assumes that carbon-14 is in equilibrium in the atmosphere — that it is being broken down at thesame rate at which it is being produced.  However, calculations made to test this assumption suggest that carbon-14 is being produced nearly one third faster than it is disintegrating.  If this is true, then none of the fossils that have been dated by this method could be more than a few thousand years old…”
  2. It is also true that cosmic rays would have been deflected away from the earth most effectively by the earth’smagnetic field if, … (it) was much stronger in the past.  With fewer cosmic rays reaching the atmosphere, there would have been less production of carbon-14 then than now.

She then adds that there is thus … “no really reliable method of dating fossils  10

Carbon dating was not invented until 1949. When the schools started to teach that the earth is billions of years old, back in 1830, the reasoning was not because of carbon dating. Carbon dating had not even been thought of yet. So why were they teaching that the earth was billions of years old back in the 1800’s? Billions of years are needed to make the evolution theory look good. Without billions of years to hide in, the theory looks absolutely ridiculous.

The geologic column is where it all started. The earth was divided up into layers. Each layer was assigned a name, an age, and an index fossil. The ages were chosen without any scientific reasoning: they were picked out of the clear blue sky! Now any dating technique that comes along, like carbon dating, has to match the geologic column: or it is rejected. This is only because the geologic column has been taught for so long now and is assumed to be true. Just because something has been taught for a long time does not make it true. However, this is the logic most scientists have. They might have to test a sample 5 or 6 times until they get the age that they want. How would you know any of the dates given are right if you are getting a different one every time?

“Radiometric dating would not have been feasible if the geologic column had not been erected first. [i]” They do not date fossils by carbon dating. Fossils are dated by their geological position. And as we mentioned earlier the dates on the geologic column were chosen out of the clear blue sky with no scientific basis. So their entire dating method for dating rocks and fossils is based off of circular reasoning.

The earth’s atmosphere is about 100 miles thick. The atmosphere has very distinctive layers to it. The earth’s atmosphere contains: 78% nitrogen, 21% oxygen, .06% carbon dioxide, and .0000765% radioactive carbon. This radioactive carbon 14 is different from regular carbon. It is produced by radiation striking the atmosphere. In essence, sunlight strikes the atmosphere, slaps the nitrogen around, and turns it into carbon 14. So it all starts by the sunlight striking the atmosphere. About 21 pounds of carbon 14 is produced every year; and that is spread out all over the world.

If you look at a periodic table you will notice that Carbon and Nitrogen are right next to each other. Nitrogen has an atomic weight of 14 and Carbon has an atomic weight of 12. If the sunlight slaps the nitrogen around, like talked about earlier, it will knock a few things off of it and it becomes Carbon 14. It still weighs as much as nitrogen, but it is now considered carbon. It is called radioactive because it is unstable and will eventually break apart. On average half of it will break down every 5,730 years.

While it is Carbon 14 it is floating around in the atmosphere and latches onto oxygen becoming carbon dioxide. During photosynthesis plants breathe in carbon dioxide and make it part of their tissue. Animals eat plants and make it part of their bodies as well. This is how Carbon 14 gets into the living world. It gets produced in the atmosphere from the sun, the plants breathe it in, and the animals eat the plants. We have all either eaten plants or eaten animals that have eaten plants. The plants are breathing in this carbon dioxide and some of the carbon is radioactive. If the atmosphere contains .0000765% radioactive carbon, it is assumed that the plants also have .0000765% radioactive carbon as well. So, you probably have .0000765% carbon 14 in you because you have been eating these plants or eating the animals that have eaten the plants.

When a plant or animal dies it stops taking in carbon 14 and whatever it had starts to decay. It was decaying while it was alive, but now there is nothing coming in to replace it. So what they do is compare the amount of carbon 14 in the fossil to the amount of carbon 14 in the atmosphere. If the fossil only contains half as much carbon 14 as the atmosphere, it is assumed to have been dead for one half-life, or 5,730 years. While it was alive it should have had .0000765% carbon 14. If a fossil only has .00003825% of carbon 14 it has been dead for one half-life. In theory the amount of carbon 14 never goes to zero. However, for practical purposes we cannot measure passed a certain amount. There should be no measurable carbon 14 after about 40,000 – 50,000 years.

“With their short 5,730 year half-life, no carbon 14 atoms should exist in any carbon older than 250,000 years. Yet it has proven impossible to find any natural source of carbon below Pleistocene (Ice Age) strata that does not contain significant amounts of carbon 14, even though such strata are supposed to be millions or billions of years old. Conventional carbon 14 laboratories have been aware of this anomaly since the early 1980’s, have striven to eliminate it, and are unable to account for it. Lately the world’s best such laboratory which has learned during two decades of low-C14 measurements how not to contaminate specimens externally, under contract to creationists, confirmed such observations for coal samples and even for a dozen diamonds, which cannot be contaminated in situ with recent carbon. These constitute very strong evidence that the earth is only thousands, not billions, of years old. [ii]”

Now think for a minute of what this means. The textbooks say that coal formed 250 million years ago. However, when coal is tested it still has carbon 14. How is that possible? If all of the carbon 14 atoms would have disappeared at a maximum of 250,000 years, why would there still be carbon 14 atoms in coal? Obviously it is not 250 million years old. Also diamonds, which they say formed millions and millions of years ago, still have carbon 14 in them. So how do you get carbon 14 in diamonds? Again it is obvious that they are not millions of years old.

The carbon dating assumptions need to be pointed out. The earth’s atmosphere is gaining 21 pounds of carbon 14 every year. It is also losing carbon 14 through decay. The question is how long would it take the atmosphere to reach a stage called equilibrium? The people who invented carbon 14 dating in the 1940’s did a lot of studies on this matter. They wanted to figure out how long it would take the atmosphere to reach a point where the construction rate and the destruction rate of carbon 14 was the same. They determined that it would take about 30,000 years to reach this equilibrium state. They made two bad assumptions after they came up with this calculation. They assumed that the earth was millions of years old and then assumed that they could ignore the equilibrium problem. It has been discovered that the earth has still not reached equilibrium. “Radiocarbon is forming 28-37% faster than it is decaying. [iii]”

Now think about that for a minute. If radiocarbon is still forming faster than it is decaying, that means the earth is less than 30,000 years old. It also means that you cannot carbon date anything! The reason is because you would have to know when the fossil was alive to know how much carbon 14 was in the atmosphere at that time. It simply does not work.

If you find a fossil in the dirt, the amount of carbon 14 can be measured and the rate of decay can be determined. However, that is all that can be determined. It is impossible to know how much carbon 14 was in it at death and it is impossible to know if carbon 14 has always decayed at the same rate.

If the earth had a canopy of water above the atmosphere, or a canopy of ice, that would have blocked out a lot of the radiation from the sun. This would have prevented most of the carbon 14 from even forming. Animals that lived before the flood would have lived in a world with much less carbon 14 to begin with. There may have been none at all, but the amount would certainly be less than what we have today.

If a C-14 date supports our theories, we put it in the main text. If it does not entirely contradict them, we put it in a footnote. And if it is completely ‘out of date’, we just drop it. [iv]” So does this mean that they simply choose any numbers that they want? That is exactly correct. If the number doesn’t fit what they expected, they throw the number out.

Here are some things to consider about carbon dating. When something of known age is dated: it doesn’t work. When something of unknown age is dated: carbon dating is assumed to work. That is not science!

Footnotes:

[i] O’Rourke, J. E., “Pragmatism versus Materialism in Stratigraphy,” American Journal of Science, vol. 276 (January 1976), p. 54
[ii] www.ICR.org
[iii] R.E. Taylor et al., “Major Revisions in the Pleistocene Age Assignments for North American Human Skeletons by C-14 Accelerator Mass Spectrometry,” American Antiquity, Vol. 50, No. 1 1985 pp. 136-140
[iv] T. Save-Soderbergh and I.U. Olsson (Institute of Egyptology and Institute of Physics respectively, Univ. of Uppsala, Sweden), C-14 dating and Egyptian chronology in Radiocarbon Variations and Absolute Chronology”, Proceedings of the twelfth Nobel Symposium, New York 1970, p. 35

The Wild Dates of Carbon Dating

A few examples of wild dates by radiometric dating:

  • Shells from living snails were carbon dated as being 27,000 years old. 3
  • Living mollusk shells were dated up to 2,300 years old. 4
  • A freshly killed seal was carbon dated as having died 1,300 years ago. 5
  • “One part of the Vollosovitch mammoth carbon dated at 29,500 years and another part at 44,000.” 6
  • “Structure, metamorphism, sedimentary reworking, and other complications have to be considered. Radiometric dating would not have been feasible if the geologic column had not been erected first.”7
  • Material from layers where dinosaurs are found carbon dated at 34,000 years old.8
  • Rocks formed in the Mount St. Helens volcano eruption in 1980 were dated from 350,000 to 2.8 million years old.
  • Rocks known to be formed in the 1950’s and 1960’s were dated to 2.4 and 3.5 million years old respectively.

Source:

Polymerase Chain Reaction Test

A method developed by Kary B. Mullis who won a Nobel Prize for its discovery. PCR was created to identify DNA viruses; the SARS-CoV2 virus is an RNA virus. Therefore, multiple steps are necessary to “magnify” the amount of genetic material in the specimen. The method has never been validated properly as an instrument to detect disease – only detect fragments of the RNA of a virus (or Chromosome 8) – not a virus itself. This is important because COVID-19 has never been identified as an actual virus. And what makes this testing even more confusing is that the FDA admits that “The detection of viral RNA by RT-PCR does not necessarily equate with an infectious virus.” 

Christian Drosten developed the fraudulent PCR Corona test in January 2020 (based on Dr. Kary Mullis’ PCR method), which from then on served as the standard method for detecting the Coronavirus SARS-CoV-2 worldwide. As Director of the Berlin Charité Institute, he is a very influential advisor to the German government and participated as an expert in many government press conferences. Thus, through his assessments, he also significantly influenced far-reaching political decisions, such as the compulsory wearing of masks, the suspension of regular school lessons, or the closure of the entire catering industry.

However, fatal mispredictions, numerous unexplained inconsistencies regarding his doctoral thesis, a hastily developed “SARS-CoV-2 PCR test” with fundamental scientific flaws, and an unsuspected quagmire of financial entanglements, deprive Christian Drosten of any credibility.

The Drosten-PCR-Tests, which were devised in January 2020, are not remotely suitable for determining whether someone is infected or not, despite being recommended as the global Gold Standard for determining infection by the WHO; it should be noted that the leadership of this organisation is under the financial control of China and the Bill & Melinda Gates Foundation (the WHO certainly has good employees – as too does the Robert-Koch Institute, despite its incompetent management).

In a retraction paper, a score of highly regarded international scientists have called on the editors of the journal which published the PCR tests as a measurement method for infections to withdraw the mischief forthwith. This test is not only scientific nonsense, but was obviously designed to create as many false positives as possible and so spread panic in the world.   This English language retraction paper has been viewed about 18 million times. Furthermore, a second assertion made in January 2020 by Drosten that there are asymptomatic infections is false.  These do not exist, as documented most recently by a major survey of ten million people from Wuhan of all places:

If a nasal or a blood sample contains a tiny snip of RNA from the SARS-CoV-2 virus, RT-PCR can possibly identify it. However – and this is important – a positive RT-PCR test result does not necessarily indicate a full virus is present. The virus must be fully intact to cross from person-to-person and cause illness. 90% of those who test positive using the PCR test, a method not meant to produce a positive or negative result, have such insignificant amounts of these RNA fragments that they are at no risk of illness and do not need to be quarantined.

Research published by the Spanish medical journal D-Salud-Discovery with a highly credible advisory board of eminently qualified physicians and scientists confirmed this. The genetic primers and probes used in RT-PCR tests to identify SARS-CoV-2 do not target anything specific. D-Salud-Discovery state there are no tests capable of identifying SARS-CoV-2. Consequently, all claims about the alleged impact of COVID 19 on population health are groundless. The entire official COVID 19 narrative is a deception. Ostensibly, there is no scientific foundation for any part of it.

The WHO’s Laboratory testing guidance states:

The etiologic agent [causation for the disease] responsible for the cluster of pneumonia cases in Wuhan has been identified as a novel betacoronavirus, (in the same family as SARS-CoV and MERS-CoV) via next generation sequencing (NGS) from cultured virus or directly from samples received from several pneumonia patients.”

The WHO’s claim is that the SARS-CoV-2 virus causes the disease COVID-19. They also allege this virus has been clearly identified by researchers in Wuhan.

In the WHO’s Novel Coronavirus 2019-nCov Situation Report 1, they state:

The Chinese authorities identified a new type of coronavirus, which was isolated on 7 January 2020……On 12 January 2020, China shared the genetic sequence of the novel coronavirus for countries to use in developing specific diagnostic kits.”

These two statements from the WHO clearly suggest the SARS-CoV-2 virus was isolated (meaning purified for study) and then genetic sequences were identified from the isolated sample. From this, diagnostic kits were developed and distributed globally to test for the virus in towns, cities and communities around the world. According to the WHO and Chinese researchers, these tests will find the virus that causes COVID 19.

Yet the WHO also state:

Working directly from sequence information, the team developed a series of genetic amplification (PCR) assays used by laboratories.”

The Wuhan scientists developed their genetic amplification assays from “sequence information” because there was no isolated, purified sample of the so called SARS-CoV-2 virus. They also showed electron microscope images of the newly discovered virions (the spiky protein ball containing the viral RNA.)

However, such protein structures are not unique. They look just like other round vesicles, such as endocytic vesicles and exosomes.

Virologists claim that it is not possible to “isolate” a virus because they only replicate inside host cells. They add that Koch’s postulates do not apply because they relate to bacteria (which are living organisms). Instead, virologists observe the virus’ cytopathogenic effects (CPE), causing cell mutation and degradation, in cell cultures.

When Chinese researchers first sequenced the full SARS-CoV-2 genome they observed CPE in Vero E6 and Huh7 cells. Vero E6 are an immortalised monkey cell line and Huh7 are immortalised cancer (tumorigenic) cells. Meaning they have been maintained in vitro (in petri dish cultures) for many years.

Central to the official SARS-CoV-2 story is the idea that it is a zoonotic virus, capable of bridging the species gap from animals to humans. When scientists from the US CDC “infected” various cells with the novel virus they noted the following:

We examined the capacity of SARS-CoV-2 to infect and replicate in several common primate and human cell lines, including human adenocarcinoma cells (A549) [lung celles], human liver cells (HUH7.0), and human embryonic kidney cells (HEK-293T), in addition to Vero E6 and Vero CCL81 [monkey cells]…No cytopathic effect was observed in any of the cell lines except in Vero cells [monkey cells]…HUH7.0 and 293T cells showed only modest viral replication and A549 cells [human lung tissue cells] were incompatible with SARS-CoV-2 infection.”

The CDC did not observe any CPE in human cells. They saw no evidence that this alleged virus caused any human illness. Nor did this supposed human virus show any notable replication in human cells, suggesting human to human infection would be impossible.

Noting this problem, a team of Polish scientists introduced this sequenced “virus” to human epithethelium (airway) cells. They observed the effects on these HAE cultures for 5 days. They noted much greater replication than the CDC scientists but ultimately stated:

“We did not observe any release of the virus from the basolateral side of the HAE culture.”

Meaning they did not see any evidence of the supposed virions breaching the cell wall membrane. Again suggesting this so called virus isn’t infectious in human beings. It is not clear that SARS-CoV-2 is a human virus capable of causing illness. It may not even physically exist. Is it nothing more than a concept based upon predictive genetic sequences?

VOYAGE OF DISCOVERY

The Wuhan Center for Disease Control and Prevention and the Shanghai Public Health Clinical Centre published the first full SARS-CoV-2 genome (MN908947.1 ). This has been updated many times. However, MN908947.1 was the first genetic sequence describing the alleged COVID 19 etiologic agent (SARS-CoV-2).

All subsequent claims, tests, treatments, statistics, vaccine development and resultant policies are based upon this sequence. If the tests for this novel virus don’t identify anything capable of causing illness in human beings, the whole COVID 19 narrative is nothing but a charade.

The WUHAN researchers stated that they had effectively pieced the SARS-CoV-2 genetic sequence together by matching fragments found in samples with other, previously discovered, genetic sequences. From the gathered material they found an 87.1% match with SARS coronavirus (SARS-Cov). They used de novo assembly and targeted PCR and found 29,891-base-pair which shared a 79.6% sequence match to SARS-CoV.

They had to use de novo assembly because they had no priori knowledge of the correct sequence or order of those fragments. Quite simply, the WHO’s statement that Chinese researchers isolated the virus on the 7th January is false.

The Wuhan team used 40 rounds of RT-qPCR amplification to match fragments of cDNA (complimentary DNA constructed from sampled RNA fragments) with the published SARS coronavirus genome (SARS-CoV). Unfortunately it isn’t clear how accurate the original SARS-CoV genome is either.

In 2003 a team of researchers from from Hong Kong studied 50 patients with severe acute respiratory syndrome (SARS). They took samples from 2 of these patients and developed a culture in fetal monkey liver cells.

They created 30 clones of the genetic material they found. Unable to find evidence of any other known virus, in just one of these cloned samples they found genetic sequences of “unknown origin.”

Examining these unknown RNA sequences they found 57% match to bovine coronavirus and murine hepatitis virus and deduced it was of the family Coronaviridae. Considering these sequences to suggest a newly discovered SARS-CoV virus (new discoveries being ambrosia for scientists), they designed RT-PCR primers to test for this novel virus. The researchers stated:

Primers for detecting the new virus were designed for RT-PCR detection of this human pneumonia-associated coronavirus genome in clinical samples. Of the 44 nasopharyngeal samples available from the 50 SARS patients, 22 had evidence of human pneumonia-associated coronavirus RNA.”

Half of the tested patients, who all had the same symptoms, tested positive for this new alleged virus. No one knows why the other half tested negative for this novel SARS-CoV virus. The question wasn’t asked.

This supposed virus had just a 57% sequence match to allegedly known coronavirus. The other 43% was just “there.” Sequenced data was produced and recorded as a new genome as GenBank Accession No. AY274119.

The Wuhan researchers subsequently found an 79.6% sequence match to AY274119 and therefore called it a novel strain of SARS-CoV (2019-nCoV – eventually renamed SARS-CoV-2). No one, at any stage of this process, had produced any isolated, purified sample of any virus. All they had were percentage sequence matches to other percentage sequence matches.

ISOLATE NOTHING

Scientists are very annoyed because they keep saying the virus has been isolated but no one believes them. This is because, as yet, no one has provided a single purified sample of the SARS-CoV-2 virus. What we have instead is a completed genome and, as we are about to discover, it isn’t particularly convincing.

Investigative journalists Torsten Engelbrecht and Konstantin Demeter asked some of the scientists who said they had images of SARS-C0V-2 virions to confirm these were images of an isolated, purified, virus. None of them could.

In Australia scientists from the Doherty Institute, announced that they had isolated the SARS-CoV-2 virus. When asked to clarify the scientists said:

“We have short (RNA) sequences from the diagnostic test that can be used in the diagnostic tests”

This explains why the Australian government state:

The reliability of COVID-19 tests is uncertain due to the limited evidence base…There is limited evidence available to assess the accuracy and clinical utility of available COVID-19 tests.”

In The UK, in July, a group of concerned academics wrote a letter to the UK Prime Minister Boris Johnson in which they asked him to:

Produce independently peer reviewed scientific evidence proving that the Covid-19 virus has been isolated.”

To date (mid-December 2020) they have not received a reply.

Similarly, UK researcher Andrew Johnson made a Freedom of Information Request to Public Health England (PHE). He asked them to provide him with their records describing the isolation of a SARS-COV-2 virus. To which they responded:

PHE can confirm it does not hold information in the way suggested by your request.”

Canadian researcher Christine Massey made a similar freedom of information request, asking the Canadian government the same. To which the Canadian government replied:

Having completed a thorough search, we regret to inform you that we were unable to locate any records responsive to your request.”

In the U.S. the Centre For Disease Control (CDC) RT-PCR Diagnostic Panel state:

…No quantified virus isolates of the 2019-nCoV are currently available……..Detection of viral RNA may not indicate the presence of infectious virus or that 2019-nCoV is the causative agent for clinical symptoms.”

Last updated on 13th July 2020, the CDC are yet to obtain any pure viral sample from any patient said to have the disease of COVID-19. They openly admit their tests don’t necessarily show if SARS-CoV-2 is either present or causes COVID 19.

We are told that none of this matters. That we are ignorant and just don’t understand virology. Therefore, we must accept pictures of things we know could be something else and genetic sequences (which could be anything else) as conclusive proof that this virus, and the disease it is supposed to cause, are real.

TESTING FOR NOTHING

The WHO, and every government, think tank, policy steering committee, government scientific advisor, supranational institutions and others who promote the official COVID 19 narrative, assert that SARS-CoV-2 causes COVID 19.

While no one has ever produced a sample of this supposed virus, the alleged SARS-CoV-2 genome has been published. It is in the public domain.

Key genetic sequences, in the SARS-CoV-2 genome, are said to have specific functions. These are the target proteins that scientists test for to identify the presence of the “virus”. These include:

  • RNA-polymerase (Rd-Rp) gene – This enables the SARS-CoV-2 RNA to replicate inside the cytoplasm of COVID 19 diseased epithelial cells.
  • S gene (Orf2) – this glycoprotein forms the spike on the SARS-CoV-2 virion surface which supposedly facilitates SARS-CoV-2 binding to the ACE2 receptors on cells, allowing the RNA inside the virion protein shell (capsid) to pass into the now infected cell.
  • E gene (Orf1ab) – small membrane protein used in viral assembly
  • N gene (Orf9a) – the nucleocapsid gene which binds the RNA in capsid formation

The WHO maintain a publicly available record of the RT-PCR primers and probes used to test for SARS-CoV-2. The primers are specific nucleotide sequences that bind (anneal) to the antisense and sense strands of the synthesised cDNA (called forward and reverse primers respectively.)

The cDNA strands separate when heated and reform when cooled. Prior to cooling, nucleotide sequences called probes are introduced to anneal to specific target regions of the suspected viral genome. During amplification, as the regions between primers elongate, when a primer strikes a probe, the probe decays releasing a fluorescent or dye which can then be read by researchers.

It is the identification of these markers which scientists claim to prove the presence of SARS-CoV-2 in a sample.

Something else which is publicly available is the Basic Local Alignment Search Tool (BLAST). This allows anyone to compare published nucleotide sequences with all those stored by the U.S. National Institutes of Health (NIH) genetic database called GenBank. Therefore we can BLAST the claimed SARS-CoV-2 primers, probes and target gene sequences.

The WHO’s forward, reverse primers and probe protocols, for the alleged SARS-CoV-2 viral genome, are based upon RdRp, Orf1, N and E gene profiles. Anyone can run them through BLAST to see what we find.

The vital RdRP nucleotide sequence, used as a forward primer is – ATGAGCTTAGTCCTGTTG. If we run a nucleotide BLAST this is recorded as a complete SARS-CoV-2 isolate with a 100% matched sequence identity. Similarly the reverse E gene primer sequence – ATATTGCAGCAGTACGCACACA – reveals the presence of the Orf1ab sequence which also identifies SARS-CoV-2.

However, BLAST also enables us to search the nucleotide sequences of the microbial and human genomes. If we search for the RdRp SARS-CoV-2 sequence it reveals 99 human chromosome with a 100% sequence identity match. The Orf1ab (E gene) returns 90 with a 100% sequence identity match to human chromosomes.

Doing the same for these sequences with a microbial search finds 92 microbes with a 100% match to the SARS-CoV-2 E gene and 100 matched microbes, with a 100% sequence identity, to the vital SARS-CoV-2 RdRp gene.

Whenever we check the so-called unique genetic markers for SARS-CoV-2, recorded in the WHO protocols, we find complete or high percentage matches with various fragments of the human genome. This suggests that the genetic sequences, which are supposed to identify SARS-CoV-2, are not unique. They could be anything from microbial sequences to fragments of human chromosomes.

So called fact checkers, like Reuters’ Health Feedback project, have been quick to dismiss the claims of those who have noticed the apparent lack of specificity in the supposed SARS-CoV-2 genome.

Using a slew of strawman arguments like, “this claim suggests every test should be positive,” (which it doesn’t) their debunking attempt runs something like this:

Primers are designed to bind to specific nucleotide sequences that are unique to the virus. The forward primer may bind to a particular chromosome but the reverse primer doesn’t bind to the same chromosome and so the chromosome is not present in the SARS-CoV-2 virus. Moreover because the forward and perverse primers envelop the sequence to be amplified the cDMA sequence between primers is unique to the virus.

This seems to deliberately misrepresent the significance of these findings by forwarding an argument that no one, other than the fact checkers themselves, are making. BLAST searches show that these target sequences are not unique to SARS-CoV-2. Nor do all targets need to be found for a result to be deemed positive.

Moroccan researchers investigated the epidemiology of Moroccan alleged cases of SARS-CoV-2. Nine percent were positive for three genes, eighteen percent were positive for two genes and seventy three percent for just one. As we have just discussed, many may have been positive for none.

This is entirely in keeping with WHO’s test guidelines. They state:

“An optimal diagnosis consists of a NAAT [nucleic acid amplification test] with at least two genome-independent targets of the SARS-CoV-2; however, in areas where transmission is widespread, a simple single-target algorithm can be used……One or more negative results do not necessarily rule out the SARS-CoV-2 infection.”

Regardless of the spurious arguments of well funded fact checkers, if the forward and reverse primers identify junk, perhaps one being the fragment of a chromosome and the other a microbial sequence, then the amplified region between them is probably junk too.

The argument that RT-PCR only finds RNA is specious. Natural transcription (the separation of DNA strands) occurs during gene expression. No one is saying whole chromosomes or microbes are sequenced in the alleged SARS-CoV-2 genome. Though they may, for all we know. They are saying the alleged markers, used to test for this supposed virus, are not fit for purpose.

RT-PCR tests do not sequence the entire genome. They look for incidents of specific probe florescence to indicate the presence of sequences said to exist. These sequences are defined by MN908947.1 and the subsequent updates. These primers and probes could reveal nothing but RNA matches extracted from non-coding, sometimes called “junk,” DNA (cDNA.)

For example the SARS-CoV-2 S gene is meant to be highly specific to the SARS-CoV-2 virus genome. The target sequence is – TTGGCAAAATTCAAGACTCACTTTC. A microbial BLAST search returns 97 microbial matches with 100% identity sequence match. The lowest identity percentage match, within the top 100, is 95%. A human genome BLAST also finds a 100% sequence match to 86 human chromosome fragments.

No matter where you look in the supposed genome of SARS-CoV-2, there is nothing in the WHO’s test protocols that clearly identifies what it is. The whole genome could be false. The tests do not prove the existence of SARS-CoV-2. All they reveal is a soup of unspecified genetic material.

If so, as there are no isolates or purified samples of the virus, without a viable test, there is no evidence that SARS-CoV-2 exists. Therefore, nor is there any evidence that a disease called COVID 19 exists.

This infers that there is no scientific basis for any claims about COVID 19 case numbers, hospital admissions or mortality figures. All measures taken to combat this deadly virus are quite possibly founded upon nothing.

During Covid-19, authorities claim that testing is important for public health officials to assess if their mitigation efforts – “shelter in place” and “social distancing” and “wearing a mask” – are making a difference to “flatten the curve.” Officials also claim that testing is necessary to know how many persons have an infection within a community and to understand the nature of how coronaviruses spread.

Despite the challenges with test kits, testing began. By the end of March 2020, more than 1 million people had been tested across the US. By May 9, the number tested had grown to over 8.7M. Testing methods include a swab of the nasal passages or by inserting a long, uncomfortable swab through the nose to scrape the back of the throat. Specimens have also been obtained bronchoalveolar lavage, from sputum, and from stool specimens.

Repeat testing of persons who have a negative test may (eventually) confirm the presence of viral RNA, but this is impractical. Additionally, repeated testing of the same person can lead to even more confusing results. The test may go from negative, to positive, then back to negative again as the immune system clears out the coronavirus infection and moves to recovery.

From the Inventor of the test who says the method was never meant to be used as a test for a virus, Kary Mullis

“Scientists are doing an awful lot of damage to the world in the name of helping it. I don’t mind attacking my own fraternity because I am ashamed of it.”

From “CDC 2019-Novel Coronavirus (2019-nCoV) Real-Time RT-PCR Diagnostic Panel” [1]:

“Detection of viral RNA may not indicate the presence of infectious virus or that 2019-nCoV is the causative agent for clinical symptoms.”

Translation: A positive test doesn’t guarantee that the COVID virus is causing infection at all. And, ahem, reading between the lines, maybe the COVID virus might not be in the patient’s body at all, either.

From the World Health Organization (WHO): “Coronavirus disease (COVID-19) technical guidance: Laboratory testing for 2019-nCoV in humans” [2]:

“Several assays that detect the 2019-nCoV have been and are currently under development, both in-house and commercially. Some assays may detect only the novel virus [COVID] and some may also detect other strains (e.g. SARS-CoV) that are genetically similar.”

Translation: Some PCR tests register positive for types of coronavirus that have nothing to do with COVID—including plain old coronas that cause nothing more than a cold.

The WHO document adds this little piece:

“Protocol use limitations: Optional clinical specimens for testing has [have] not yet been validated.”

Translation: We’re not sure which tissue samples to take from the patient, in order for the test to have any validity.

From the FDA:

“LabCorp COVID-19RT-PCR test EUA Summary: ACCELERATED EMERGENCY USE AUTHORIZATION (EUA) SUMMARYCOVID-19 RT-PCR TEST (LABORATORY CORPORATION OF AMERICA)” [3]:

“…The SARS-CoV-2RNA [COVID virus] is generally detectable in respiratory specimens during the acute phase of infection. Positive results are indicative of the presence of SARS-CoV-2 RNA; clinical correlation with patient history and other diagnostic information is necessary to determine patient infection status…THE AGENT DETECTED MAY NOT BE THE DEFINITE CAUSE OF DISEASE (CAPS are mine). Laboratories within the United States and its territories are required to report all positive results to the appropriate public health authorities.”

Translation: On the one hand, we claim the test can “generally” detect the presence of the COVID virus in a patient. But we admit that “the agent detected” on the test, by which we mean COVID virus, “may not be the definite cause of disease.” We also admit that, unless the patient has an acute infection, we can’t find COVID. Therefore, the idea of “asymptomatic patients” confirmed by the test is nonsense. And even though a positive test for COVID may not indicate the actual cause of disease, all positive tests must be reported—and they will be counted as “COVID cases.” Regardless.

From a manufacturer of PCR test kit elements, Creative Diagnostics, “SARS-CoV-2 Coronavirus Multiplex RT-qPCR Kit” [4]:

“Regulatory status: For research use only, not for use in diagnostic procedures.”

Translation: Don’t use the test result alone to diagnose infection or disease. Oops.

“non-specific interference of Influenza A Virus (H1N1), Influenza B Virus (Yamagata), Respiratory Syncytial Virus (type B), Respiratory Adenovirus (type 3, type 7), Parainfluenza Virus (type 2), Mycoplasma Pneumoniae, Chlamydia Pneumoniae, etc.”

Translation: Although this company states the test can detect COVID, it also states the test can read FALSELY positive if the patient has one of a number of other irrelevant viruses in his body. What is the test proving, then? Who knows? Flip a coin.

“Application Qualitative”

Translation: This clearly means the test is not suited to detect how much virus is in the patient’s body. I’ll cover how important this admission is in a minute.

“The detection result of this product is only for clinical reference, and it should not be used as the only evidence for clinical diagnosis and treatment. The clinical management of patients should be considered in combination with their symptoms/signs, history, other laboratory tests and treatment responses. The detection results should not be directly used as the evidence for clinical diagnosis, and are only for the reference of clinicians.”

Translation: Don’t use the test as the exclusive basis for diagnosing a person with COVID. And yet, this is exactly what health authorities are doing all over the world. All positive tests must be reported to government agencies, and they are counted as COVID cases.

Those quotes, from official government and testing sources, torpedo the whole “scientific” basis of the test.

In an excellent interview with Celia Farber, she exposes many of the flaws in the test:

How many of us are “infected” with this novel Corona virus, and how scared should we be?

People die—yes. But people don’t die at the mercy of malicious, predatory pathogens, “lurking” on every surface, and especially other humans. That’s not “science.” That’s social engineering. Terrorism.

What do we mean when we say a person “tests positive” for Covid-19?

We don’t actually mean they have been found to “have” it. We’ve been hijacked by our technologies, but left illiterate about what they actually mean. In this regard, I spent time with, and interviewed the inventor of the method used in the presently available Covid-19 tests, which is called RT-PCR, (Polymerase Chain Reaction.). His name is Kary B. Mullis, he passed away in August of last year (2019). He was one of the warmest, funniest, most eclectic-minded people I ever met, in addition to being a staunch critic of HIV “science,” and an unlikely Nobel Laureate, i.e. a “genius.”

One time, in 1994, when I called to talk to him about how PCR was being weaponized to “prove,” almost a decade after it was asserted, that HIV caused AIDS, he actually came to tears. The people who have taken all of your freedoms away, they’re social engineers, politicians, globalist thought leaders, bankers, foundations, HO fanatics, and the like. Their army is composed of “mainstream media,” which is now literally a round-the-clock perfect propaganda machine in support of the so-called “Pandemic”.

Kary Mullis was a scientist. He never spoke like a globalist, and said once, memorably, when accused of making statements about HIV that could endanger lives: “I’m a scientist. I’m not a lifeguard.” That’s a very important line in the sand.  Somebody who goes around claiming they are “saving lives,” is a very dangerous animal, and you should run in the opposite direction when you encounter them. Their weapon is fear, and their favorite word is “could.” They entrap you with a form of bio-debt, creating simulations of every imaginable thing that “could” happen, yet hasn’t.

Bill Gates has been waiting a long time for a virus with this much, as he put it, “pandemic potential.” But Gates has a problem, and it’s called PCR.

What does HIV have to do with Covid-19?

PCR played a central role in the HIV war (a war you don’t know about, that lasted 22 years, between Globalist post-modern HIV scientists and classical scientists.) The latter lost the war. Unless you count being correct as winning. The relentless violence finally silenced the opposition, and it seemed nobody would ever learn who these scientists were, or why they fought this thing so adamantly and passionately.

And PCR, though its inventor died last year, and isn’t here to address it, plays a central role in Corona terrorism.

To read the complete article click here

Continue on next page…

Face Masks

Not a single randomized controlled trial with verified outcome has been able to detect a statistically significant advantage of wearing a mask versus not wearing a mask, when it comes to preventing infectious viral illness. If there were any significant advantage to wearing a mask to reduce infection risk to either the wearer or others in the vicinity, then it would have been detected in at least one of these trials, yet there’s no sign of such a benefit. There is no evidence that masks are of any utility for preventing infection by either stopping the aerosol particles from coming out, or from going in. You’re not helping the people around you by wearing a mask, and you’re not helping yourself avoid the disease by wearing a mask.

Mask wearing was blueprinted in the Rockerfeller Foundation’s Lockstep scenario in order to achieve “a world of tighter top-down government control and more authoritarian leadership, with limited innovation and growing citizen pushback.

Aldous Huxley’s dystopian Brave New World predicts a totalitarian society where people love their servitude. As Del Bigtree points out in his video (bottom of article), it is shocking to see so many loving their tyrannous new normal of wearing masks and policing those they don’t, happily social distancing and quarantining themselves under the guise of safety from a novel (fictitious) coronavirus.

The truth is masks have become the new wedge issue, the latest phase of the culture war. Mask opponents tend to see mask wearers as “fraidy cats” or virtue-signalling “sheeple” who willfully ignore basic science. Mask supporters, on the other hand, often see people who refuse to wear masks as selfish Trumpkins … who willfully ignore basic science. There’s not a lot of middle ground to be found and there’s no easy way to sit this one out. We all have to go outside, so at some we all are required to don the mask or not.

It’s clear from the data that despite the impression of Americans as selfish rebel cowboys who won’t wear a mask to protect others, Americans are wearing masks far more than many people in European countries. Polls show Americans are wearing masks at record levels, though a political divide remains: 98 percent of Democrats report wearing masks in public compared to 66 percent of Republicans and 85 percent of Independents. (These numbers, no doubt, are to some extent the product of mask requirements in cities and states.) Whether one is pro-mask or anti-mask, the fact of the matter is that face coverings have become politicized to an unhealthy degree, which stands to only further pollute the science.

Assuming the germ theory accepted by the medical industry is correct instead of the terrain theory proposed by most natural healers, infectious viral respiratory diseases primarily spread via very fine aerosol particles that are in suspension in the air. Any mask that allows you to breathe therefore allows for transmission of aerosolized viruses. All-cause mortality data are not affected by reporting bias. A detailed study of the current data of all-cause mortality shows the all-cause mortality this past winter was no different, statistically, from previous decades. COVID-19 is not a killer disease, and this pandemic has not brought anything out of the ordinary in terms of death toll.

Unfortunately, the mainstream propaganda and government orders in many states reverted back toward mask wearing just about everywhere. You’re not allowed into stores; you cannot fly or take a cab, Uber or Lyft without one; you must wear one everywhere you go, even outdoors, and if you don’t you’re vilified, sometimes aggressively attacked. It has no basis and only induces fear, anxiety, and potential sickness for perfectly healthy people. Hmmm, just what the globalists want! How convenient.

Compliance is not enough. Popular actor Laurence Fox, interviewed on New Culture Forum, said that despite wearing a mask in shops and on public transport, he is still being criticised. You shouldn’t complain, he is told. Instead, you should feel happy. A mask shows that you care, purportedly, and that you are a good person – unlike those ignoramuses and conspiracy theorists who recklessly and selfishly endanger others. As Fox perceives, the coronavirus pandemic is being used to display moral superiority.

Masks have become a fault line in the culture war. Laws and the threat of fines force the majority of people to comply, but there is a thinly veiled contrast between those who want to wear them and those who dislike this excessive response to a mostly mild upper respiratory tract infection. The divide is heavily influenced by social class and ideology.

The mask advocates get their way, because they are the establishment, supported by the legions of graduates of campus puritanism. In this regime of Cultural Maskism, the ordinary folk are cast as germ-spreaders. And so sophisticates must mask themselves from the contagious plebs, who must themselves be muzzled – not only to control the virus that they carry, but also to silence their opposition to an unprecedented loss of liberty.

An underreported, recently-published CDC study adds to the pile of evidence that cloth masks or other forms of mandated face coverings only contribute negatives to our COVID-19 problem. The study also displays — despite the constant accusations of widespread misbehavior from public health officials — that Americans are adhering to mask wearing, but mask wearing is not doing us any good.

The CDC study, which surveyed symptomatic COVID-19 patients, has found that 70.6% of respondents reported “always” wearing a mask, while an additional 14.4% say they “often” wear a mask. That means a whopping 85% of infected COVID-19 patients reported habitual mask wearing. Only 3.9% of those infected said they “never” wear a face covering.

Denis Rancourt, Ph.D., a former full professor of physics and researcher with the Ontario Civil Liberties Association in Canada, did a thorough study of the scientific literature on masks, concentrating on evidence showing masks can reduce infection risk, especially viral respiratory diseases.

“What I found when I looked at all the randomized controlled trials with verified outcome, meaning you actually measure whether or not the person was infected … NONE of these well-designed studies that are intended to remove observational bias … found there was a statistically significant advantage of wearing a mask versus not wearing a mask.

Likewise, there was no detectable difference between respirators and surgical masks. That to me was a clear sign that the science was telling us they could not detect a positive utility of masks in this application.

We’re talking many really [high-]quality trials. What this means — and this is very important — is that if there was any significant advantage to wearing a mask to reduce this [infection] risk, then you would have detected that in at least one of these trials, [yet] there’s no sign of it.

That to me is a firm scientific conclusion: There is no evidence that masks are of any utility either preventing the aerosol particles from coming out or from going in. You’re not helping the people around you by wearing a mask, and you’re not helping yourself preventing the disease by wearing a mask.

This science is unambiguous in that such a positive effect cannot be detected. So, that was the first thing I publicized. I wrote a large review1,2 of the scientific literature about that.

But then I asked myself, as a physicist and as a scientist, why would that be? Why would masks not work at all? And so, I looked into the biology and physics of how these diseases are transmitted.”

Rancourt did a detailed study of the current data of all-cause mortality (which removes all bias from the equation), showing that the all-cause mortality for the 2020 winter was no different, statistically, from previous decades. In other words, COVID-19 is not a killer disease, and this pandemic has not brought anything out of the ordinary in terms of death toll. He published this data in the paper ,“All-Cause Mortality During COVID-19: No Plague and a Likely Signature of Mass Homicide by Government Response.

Many firmly believe wearing a mask in public will protect themselves and/or others, and one of the reasons for this is because they appear to work in some circumstances, such as operating rooms. If they don’t work, why do surgical staff and many health care workers use them on a regular basis? As explained by Rancourt, the reason surgical masks are worn in the operating room is to prevent spittle from accidentally falling into an open wound, which could lead to infection. Surgical masks have been shown to be important in that respect.

Preventing microbes and bacteria from falling into an open wound is very different from preventing the spread of viral particles, however. Not only are viruses much smaller than bacteria and many other microbes found in saliva, they are, again, airborne. They’re aerosolized and part of the fluid air. Therefore, if air can penetrate the mask, these aerosol particles can also get through.

Now, one view is that, even though a mask may not protect the wearer against contracting an infection, it will still protect others that the mask-wearer comes into contact with. But that’s not what the science shows. The measured outcome in most rigorous studies on this is the infection rate. Did anyone involved get infected?

Comparisons are made between health care workers wearing masks, respirators or nothing at all. While this does not allow you to discern who is being protected — the mask wearer or others — the studies show mask wearing does neither.

Since everyone is in close proximity to each other, and no differences in infection rates are found regardless of what type of mask is worn, or none at all, it tells us that mask wearing protects no one from viral infections.

“It makes no difference if everybody in your team is wearing a mask; it makes no difference if one is and others aren’t,” Rancourt says. “Wearing a mask or being in an environment where masks are being worn or not worn, there’s no difference in terms of your risk of being infected by the viral respiratory disease.

There’s no reduction, period. There are no exceptions. All the studies that have been tabulated, looked at, published, I was not able to find any exceptions, if you constrain yourself to verified outcomes.”

What’s more, the results are the same for both N95 respirators and surgical masks. Respirators offer no protective advantage when it comes to viral infections.

“In one of the randomized control trials, a big one that compared masks and N95 respirators among health care workers, the only statistically significant outcome they discovered and reported on was that the health care workers who wore the N95 respirators were much more likely to suffer from headaches,” Rancourt says.

“Now, if you’ve got a bunch of health care workers, which you’re forcing to get headaches, how good is the healthcare going to be?”

Studies have conclusively proven masks do not prevent viral infections. Why, is another question. One commonsense explanation put forth by Rancourt is that masks don’t work for this application for the simple fact that they allow airflow.

“I’ve come to the conclusion that the most prominent vector of transmission is these fine aerosol particles. Those fine aerosol particles will follow the fluid air. In a surgical mask, there is no way you’re blocking the fluid air. When you breathe wearing a surgical mask, the lowest impedance of airflow is through the sides and tops and bottoms of the mask.

In other words, very little of the airflow is going to be through the actual mask. The mask is only designed and intended to stop your spitballs from coming out and hitting someone … If the flow of air is through the sides, whatever molecules or small particles are carried in the air, are going to flow that way as well, and that’s how you get infected.

If you’re not stopping [the viral particles] coming in, you’re not stopping them from coming out either. They follow the flow, period. That’s the way it is. So that’s why there’s an equivalence between ‘It doesn’t protect you and it doesn’t protect anyone else either.’”

Ironically, some masks are even designed with out-vents, to facilitate breathing, which completely negate the claim that mask-wearers are protecting others.

(from NoMoreFakeNews) Mask wearers of the world, take them off—you have nothing to lose but your insanity…

Journal of the American Medical Association, April 17, 2020, “Masks and Coronavirus Disease”: “Unless you are sick, a health care worker, or caring for someone who has COVID-19, medical masks (including surgical face masks and N95s) are not recommended.”

At Children’s Health Defense, JB Handley has written an excellent article, “LOCKDOWN LUNACY: The Thinking Person’s Guide.” Here are two highlights from his section on masks:

“May 29, the World Health Organization announced that masks should only be worn by healthy people if they are taking care of someone infected with COVID-19:”

“’If you do not have any respiratory symptoms such as fever, cough or runny nose, you do not need to wear a mask,’ Dr. April Baller, a public health specialist for the WHO, says in a video on the world health body’s website posted in March. ‘Masks should only be used by healthcare workers, caretakers or by people who are sick with symptoms of fever and cough’.”

“…I often see this study from 2015 in the BMJ cited: ‘A cluster randomised trial of cloth masks compared with medical masks in healthcare workers’, and it bears repeating, since MOST of the masks I see people wearing in the community right now are cloth masks. Not only are these masks 100% ineffective at reducing the spread of COVID-19, but they can actually harm you. As the researchers explain:”

“’This study is the first RCT of cloth masks, and the results caution against the use of cloth masks. This is an important finding to inform occupational health and safety. Moisture retention, reuse of cloth masks and poor filtration may result in increased risk of infection…’”

Of course, when people are conspiracy whackos wearing their masks, they don’t respond well to facts, even when those facts come from the very organizations they believe in with religious fervor.

Here is something else from the Washington State Nurses Association: “Reprocessing masks using toxic chemicals is not a solution”:

“Nurses are reporting that respirators and face masks at WSNA repre-sented Providence facilities are being collected for reprocessing using ethylene oxide to decontaminate. The EPA has concluded that ethylene oxide is carcinogenic to humans and that exposure to ethylene oxide increases the risk of lymphoid cancer and, for females, breast cancer.”

“WSNA sent a cease and desist demand to Providence facilities where our members work, demanding an immediate halt to the reusing of any face masks, including N 95 and other respirators, that have been decontaminated by the ethylene oxide cleaning process. In addition, WSNA is preparing complaints to be filed with the Washington State Department of Occupational Safety and Health, highlighting this workplace hazard.”

“WSNA believes that the reuse of face masks or respirators cleaned with ethylene oxide violates the employer’s legal duty to ensure that nurses and other health care workers are afforded a safe and healthful working environment. While hospitals have long used ethylene oxide to clean certain surgical equipment, it should not be used to decontami-nate face masks or respirators, through which nurses and other health care workers must breathe for many hours at a time.”

“…The CDC warns that ethylene oxide is carcinogenic and teratogenic, and that ‘inhalation of ethylene oxide has been linked to neurologic dysfunction and may cause other harmful effects to the wearer’.”

“Prolonged exposure to ethylene oxide can hurt eyes and LUNGS, harm the brain and nervous system, and potentially cause lymphomas, leukemia, and breast cancer. This extremely hazardous toxic chemical poses a severe risk to human health.” [CAPS are mine.]

Is the use of toxic ethylene oxide to treat masks widespread? According to the Chicago Tribune, way back in March, Medline Industries was reprocessing 100,000 medical masks a day. They applied to the FDA for permission to use ethylene oxide. But wasn’t the horse already out of the barn? Weren’t they already using the chemical? I’ve queried Medline to find out whether the FDA has approved their application.

And finally, I have a lone report about a person from the region of Piedmont, Italy, who checked out his medical mask, which he’d received in the mail from the Department of Civil Protection. He discovered it contained zinc pyrithione.

If true, this is ominous. Consulting a simple safety data sheet on the chemical, from Cayman Chemical, I found a succinct statement: “Toxic if inhaled.”

But of course, medical masks must be worn. The lockdown authorities tell us so. They know. They must know because, well, they’re on television. Keep breathing through that mask. It’s “safe and effective.”

Patricia Neuenschwander, M.S.N., R.N., C.P.N.P.-P.C., an emergency room nurse with over two decades of experience, the science doesn’t support healthy people wearing masks. When Neuenschwander found out that her grandchild’s Montessori preschool was going to require even toddlers to wear masks, she did a deep dive into the research to better educate herself and her grandchild’s school about mask-wearing. The info below is an abbreviated verion of the FULL ARTICLE HERE

An important study using science to evaluate cloth mask use to prevent infection was conducted in March 2011. It is a large, prospective, randomized clinical trial; and the first randomized clinical trial ever conducted of cloth masks. The international team of researchers concluded:

This study is the first RCT of cloth masks, and the results caution against the use of cloth masks. This is an important finding to inform occupational health and safety. Moisture retention, reuse of cloth masks and poor filtration may result in increased risk of infection. Further research is needed to inform the widespread use of cloth masks globally. However, as a precautionary measure, cloth masks should not be recommended for HCWs, particularly in high-risk situations, and guidelines need to be updated.”

More recently, researchers from University of Illinois at Chicago School of Public Health reviewed the scientific literature. While not an exhaustive review of masks and respirators as source control and personal protection equipment (PPE), this review was made in an effort to locate and review the most relevant studies of laboratory and real-world performance to inform our recommendations. The review, which has 52 citations, concludes:

“We do not recommend requiring the general public who do not have symptoms of COVID-19-like illness to routinely wear cloth or surgical masks becauseThere is no scientific evidence they are effective in reducing the risk of SARS-CoV-2 transmission”

2020 study in Seoul, South Korea looked at the effectiveness of surgical and cotton masks in blocking COVID-19 in a controlled comparison of four patients. The COVID-infected patients were put in negative pressure isolated rooms. The scientists compared disposable surgical masks (3 layers) with reusable cotton masks.

Patients were instructed to cough 5 times while wearing no mask, surgical mask, or cotton mask. Interestingly, all swabs from the outer masks—including surgical masks—were positive for COVID-19. Inner masks were also found to be contaminated. That means the mask did not effectively filter out the COVID virus since it is too small. The authors assert:

Neither surgical nor cotton masks effectively filtered {COVID-19} during coughs by infected patients.” Conclusion: “both surgical and cotton masks seem to be ineffective in preventing the dissemination of SARS–CoV-2 from the coughs of patients with COVID-19 to the environment and external mask surface.”

“There is no specific evidence to suggest that the wearing of masks by the mass population has any potential benefit,” Dr. Mike Ryan, an epidemiologist who specializes in infectious diseases and public health and who is the executive director of the WHO health emergencies program, said at a media briefing. “In fact, there’s some evidence to suggest the opposite in the misuse of wearing a mask properly or fitting it properly” (source).

The CDC has claimed for decades that the influenza virus is transmitted person to person, but we have never been told to wear a mask to stop the spread of that virus. As a matter of fact, the CDC specifically says masks don’t work; and they do not recommend wearing a mask, to prevent transmission of the flu!

No recommendation can be made at this time for mask use in the community by asymptomatic persons, including those at high risk for complications, to prevent exposure to influenza viruses” (source).

Asymptomatic infections do not exist, as documented most recently by a major survey of ten million people from Wuhan of all places. A person who has no symptoms is healthy.  This means that no-one need be fearful of people without symptoms or force them to wear masks, and no-one must be frightened that a positive test means that the person who has tested positive is infected.  Horror pictures of hospitals with beds in the corridors are again doing the rounds – such scenes occur every year during a completely normal influenza outbreak: such pictures are used solely in order to spread panic.  There is still no excess mortality in Germany – it is perfectly normal for more people to die in winter.

Dr. Shanna Swan, a professor of Environmental Medicine & Public Health at Mount Sinai Health System, has warned in a book that phthalates, a chemical commonly used in the manufacturing of plastics, can shrink penises and decrease male fertility. A study listed in the National Center for Biotechnology Information, which operates under the National Library of Medicine and the National Institutes of Health, found that the microplastics used in the manufacturing of Covid face masks contain a number of toxic chemicals, including the penis-shrinking phthalates.

Masks make children fearful 

I have not been able to locate any published research on the psychological or emotional effects of having healthy children wear masks daily for hours at a time. I can only make an educated assumption based on over two decades of working as a healthcare professional that forcing children to wear masks will cause fear, anxiety, and negative feedback from caregivers. Mask wearing will affect children differently based on their developmental level. You cannot explain to a two-year-old why they are being forced to cover their nose and mouth.

Covering the mouth and nose for hours is not only uncomfortable for children (and adults), it also limits the airflow and the flow of oxygen coming in. It causes children, as with adults, to breath their own carbon dioxide, which we know is harmful. In addition, it provides a dark, warm, moist environment that potentially increases the risk of infection.

A first-of-its-kind study, involving over 25,000 children, revealed that masks are harming schoolchildren in many physical and psychological ways and have a negative effect on their behavior, focus and interest in learning. These negative effects are censored from social media, under-reported by the media, and ignored by government officials. Of the 25,930 children studied, the database includes at least 17,854 health complaints submitted by parents. These health issues and impairments were observed in approximately 68 percent of masked schoolchildren who were forced to wear a face covering for an average of four and a half hours per day.

The registry, established on October 20th, 2020, asked 363 doctors to inform parents and teachers that they can report the health impacts they are witnessing from prolonged mask use of children. The health issues were exhaustive and included irritability (60%), headache (53%), difficulty concentrating (50%), less happiness (49%), reluctance to go to school/kindergarten (44%), malaise (42%) impaired learning (38%) and drowsiness or fatigue (37%).” Nearly a third of the children sleep worse than normal, and quarter of the children had developed new fears. Hundreds of children were less cheerful, less playful and most were unusually irritable.

Even more concerning, (29.7%) had shortness of breath, (26.4%) experienced dizziness, and hundreds of children suffered from feelings of weakness, a feeling of disease, accelerated respiration, tightness in the chest, and short-term impairment of consciousness. Universal mask wearing is destroying the health of children, making their immune system more susceptible to disease. (Related: The CDC is developing a nationwide “medical police state” program to track vaccine compliance; may lead to “medical kidnapping” of children.)

Around the world, fathers and mothers are losing their parental rights as asinine medical interventions are mandated on their children in the school setting. Children are being psychologically raped, as adults force them to believe that their breath is a constant source of disease transmission, that they have a moral duty to ensure that their diseased breath never infects another person. Children are being trained to fear one another, to fear the world around them, and to quiver in obedience to authority and medical fraud. Will these institutions be held liable for the physical, psychological and behavioral harm they continue to impose on children?

Teachers and counselors, who are required by law to report child abuse, are now actively participating in the abuse of children and bullying parents to comply. Every day, authorities turn a blind eye to the psychological harm they impose on children with mandatory masking of each child’s mouth and nose. What else can be forced onto children under the guise of keeping everyone “safe?”

Masking of schoolchildren is a medical experiment. Mask manufacturers have not conducted independent studies for long term use of their products on adolescents. Therefore, parents are not given informed consent so they can make a choice that is best for their child. In most cases, the schools are dictating what parents must do to their child’s body, setting unlawful precedent that tramples on the medical privacy rights of the family while perpetuating institutional abuse of children that is liability-free.

“There are no manufacturer-independent studies on the use of masks for children and adolescents that are certified as medical products for occupational safety in professional applications,” the study authors stated. “In addition, due to the unknown materials used, there are no findings on the potential protective effects or side effects of the often home-made ‘everyday masks’ worn by the majority of children. In view of the ongoing measures to contain the COVID-19 pandemic, and in particular the varying obligations for children and adolescents to wear masks in school over a longer period of time, there is an urgent need for research.”

Republican Ohio State Rep. Nino Vitale released a video showing a live experiment with students who placed an oxygen-reading device into their face masks to check if the levels were safe. The Occupational Safety and Health Administration (OSHA) “considers any atmosphere with an oxygen level below 19.5 percent to be oxygen-deficient and immediately dangerous to life or health.”1

Fear is driving this recommendation for healthy people to wear masks, not science.

Are mask-wearers being initiated into a cult by the Luciferian social engineers?

As a nurse for over 25 years and holding a Master’s Degree in Science, I cannot in good conscience allow my grandchild to be subjected to an intervention that may cause physical, emotional, and psychological harm without being provided significant evidence that the benefits of such intervention outweigh the risks.

Should we be encouraging healthy people to wear masks? The answer is unequivocally no.

Rancourt says:

 “The World Health Organization in its June 5 memo,4 where they reversed their position and decided that it was a good idea to recommend mask use in the general population, in that document, they actually say you have to consider the potential harms, and they list what they consider are all the potential harms.

They missed a lot. But one of the top ones is you’re concentrating the pathogen laden material onto this material near your face, nose, eyes and so on. And you’re touching the mask all the time, you’re touching yourself, you’re touching others.

It’s not a controlled clinical environment, so there’s potential for transmission in that way. You might wear the mask more than once, you might store it at home and then wear it again. You might do all kinds of things …

What I find extraordinary is that they also have a list of what they call potential advantages. And when I compare the two lists, the potential dangers far outweigh the potential advantages. So, you have to ask yourself, what the heck are you doing?

How can you make these two columns and compare the advantages and disadvantages and have one clearly outweigh the other and then conclude that therefore we recommend masks? This is just nonsense. It’s irrational. So, my association added our list5 of things that they weren’t even considering.

We went into the civil liberties aspect of it as well, because I think this is very important. One of the fundamental aspects of a free and democratic society is that the individual is entitled to evaluate the personal risk to themselves when they act in the world.”

As noted by Rancourt, risk evaluation is a very personal thing. It involves your personality, your judgment, your knowledge, your experience and your culture. It’s a very personal thing that you’re entitled to do for yourself. If the state is forcing you to accept their evaluation of risk, then this fundamental precept is violated. What’s worse, they’re currently forcing you to accept an evaluation of risk that cannot be scientifically justified.

Henning Bundgaard, chief physician at Denmark’s Rigshospitale, according to Bloomberg News said:

All these countries recommending face masks haven’t made their decisions based on new studies.”

Dutch Medical Care Minister Tamara van Ark said:

“From a medical point of view, there is no evidence of a medical effect of wearing face masks, so we decided not to impose a national obligation.”

As of August 4, 2020, the Danes had suffered only 616 COVID-19 deaths, less than a third of average flu and pneumonia deaths, according to figures from Johns Hopkins University.

Coen Berends, spokesman for the National Institute for Public Health and the Environment, echoing statements similar to the US Surgeon General from early March, said :

“Face masks in public places are not necessary, based on all the current evidence. There is no benefit and there may even be negative impact.”

Mask Mandates Are Indicative of Rising Totalitarianism

The problem with mask mandates is that public health officials are not merely recommending a precaution that may or may not be effective. They are using force to make people submit to a state order that could ultimately make individuals or entire populations sicker, according to world-leading public health officials. That is not just a violation of the Effectiveness Principle. It’s a violation of a basic personal freedom.

In its letter6 to the WHO, the Ontario Civil Liberties Association also addressed the issue of mask mandates as an instrument of totalitarianism.

“In our letter, we put it this way. There’s a recent scientific study7 that came out in 2019. The first author is the executive director of the Ontario Civil Liberties Association that I do research for, and he’s a physicist also. He wrote an article with another physicist.

They looked at the conditions under which a society will gradually degrade towards a more totalitarian state. What they found was that there were two major control parameters that characterize the society that will tell you if that is likely to happen or not.

One of those control parameters is authoritarianism in the society. What they mean by that is, how successful can an individual be to refuse something, like to refuse to wear a mask if they protest? What is the chance that they’ll succeed if they refuse? That would be related to the degree of authoritarianism.

The other important parameter is the degree of violence in the society. How violent is the repression if you disobey? So how big is the fine? Can you go to jail? How much punishment will you be subjected to if you disobey a particular rule, for example, wearing of a mask?

Those two parameters, they were able to establish what we call a phase diagram of societies … And what they found is that in present society, if you would estimate the average value of those two parameters for United States or Canada, we’re in a state right now where the society is very gradually evolving towards totalitarianism.

The way to slow that and prevent it is for people to object and to scale it back. As soon as you agree with an irrational order, an irrational command that is not science-based, then you are doing nothing to bring back society towards the free and democratic society that we should have. You are allowing this slow march towards totalitarianism. That’s how I would explain the importance of objecting to this.”

Mask Mandates Allow Government to Shirk Responsibility

Rancourt also points out that when government and health institutions convince people that masks are the solution, they are effectively removing their duty of care toward you, because they’re saying all you need to do is wear a mask. This allows them to avoid the responsibility of actually preventing transmission in the primary centers of transmission, such as hospitals, nursing homes and elsewhere.8

“We don’t have to manage the air in such a way that immune-vulnerable in this establishment will not be at risk of dying and so on. They remove their duty of care responsibilities by saying, ‘Well, we’re just not going to allow visitors, and we’re going to force everyone to wear masks.’

You need to look at, scientifically, what is happening here. Why are people at risk? What is immune-vulnerability due to? What can you do about it? And then you have to do something about it if you’re serious about your duty of care towards these people. So it has that side effect of letting them get away with not taking care of the people that they’re responsible for.”

Calls for Peaceful Civil Disobedience Are Growing

The Ontario Civil Liberties Association has issued a press release9 calling for peaceful civil disobedience against mandatory masking. The U.S. nonprofit Stand for Health Freedom is also calling for civil disobedience, and has a widget you can use to contact your government representatives to let them know wearing a mask must be a personal choice.

“In the memo that was put out, we explain how best to perform that civil disobedience. We explain that you should be calm and confident and not get into arguments and not try to convince the authorities.

Just express your disobedience regarding this rule. And then we explain that they may want to trespass you, they may want to give you a fine, that you can anticipate fighting that fine in court. We go through the steps so that people can visualize how to do this.

We explain that some of their core shoppers or core citizens will be angry and aggressive, and to not get into a fight and not to get into a war of words. Do not try to convince them. Just stick to that you are not going to comply. Be very calm. This kind of civil disobedience has been successful at various times in North American history.

There are risks involved, but it’s often worth it to the individual to have that civil disobedience because there are many individuals that don’t know what to do that are very angry because they’re being forced to wear masks and they see it as absurd and a constraint. So, we try to give them a view of a venue on how to resist this …

We also recommend when people are practicing this kind of civil disobedience that they not be isolated, that they try to form a grassroots group of support and that they don’t do it alone. Try to bring at least one person, one supporter, with them. Record the interaction with the authorities and report back on social media and to their groups with details of what happened and so on.

We hope to create kind of a smoother messaging that a lot of people, or at least some people, do not believe this mask story and do not believe that they are at risk and are willing to practice civil disobedience to make that point.”

Rob Pue writes:

Wearing masks is dehumanizing and degrading.  They turn us from being unique individuals, made in the image of God to a herd of dumb animals — or robots.  Mask requirements immediately steal our freedom of expression and freedom of choice. Combined with “social distancing,” they rob us of one-on-one interaction with others.  This WEARS  on people mentally, emotionally, physically and spiritually.  There have been more suicides in response to this “planned-demic” than deaths from the virus itself.

SOURCES:

See also:

Here are more videos to prove wearing masks is not smart:

Social Distancing

Part of the new normal where people are suggested, required, or demanded (depending on local & regional authorities) to not come within 6 feet of each other during the COVID-19 pandemic. The unscientific protocol was first introduced to the masses in March 2020 to flatten the curve of the COVID-19 coronavirus that was falsely estimated to kill tens or hundreds of millions, but even after the much smaller curve showed a decline (in spite of increased testing) the globalists insisted social distancing become a permanent part of our lives… for the greater good.

Sadly, “social distancing” was pounded into everyones heads so relentlessly by the mainstream media that a big chunk of the population became big believers in it. Democratic and republican cities sought to enforce social distancing as everything that wasn’t deemed essential (abortion clinics essential, but most small businesses, churches, parks, and beaches were non-essential) however things quickly changed for the left.

It was only after months of CDC and mainstream media propaganda that on 21 Sept 2020, the CDC quietly backtracked on warning that coronavirus is airborne. This came after the CDC had warned that the virus spreads most commonly through the air and was highly contagious to keep us all in fear with lockdowns, masks, and social distancing. We know now that there may not even be a virus as it has never been isolated and purified, and was computer generated from snippets just like the Nebraska man and Piltdown man hoaxes were fabricated from a tiny part (a pigs tooth and an orangutan jaw respectively) to assume the whole and sell us on evolution. Dr. Tom Cowan breaks down another CDC report on how the virus was invented:

First, in the section titled ‘Whole Genome Sequencing,’ we find that rather than having isolated the virus and sequencing the genome from end to end, they found 37 base pairs from unpurified samples using PCR probes. This means they actually looked at 37 out of the approximately 30,000 of the base pairs that are claimed to be the genome of the intact virus. They then took these 37 segments and put them into a computer program, which filled in the rest of the base pairs.

Using the ASSUMED new virus, in an UN-ISOLATED STATE, the researchers try to prove it is harmful by injecting it on to several different types of cells in the lab.

…using their own methods, the virologists found that solutions containing SARS-CoV-2 — even in high amounts — were NOT, I repeat NOT, infective to any of the three human tissue cultures they tested. In plain English, this means they proved, on their terms, that this ‘new coronavirus’ is not infectious to human beings. It is ONLY infective to monkey kidney cells, and only then when you add two potent drugs (gentamicin and amphotericin), known to be toxic to kidneys, to the mix.”

Well how and why are so many people dying you ask? The Disease rename game. They’ve been playing it for years. Take a look at the data where flu and pneumonia deaths tanked as soon as the COVID-19 plandemic arrived in February. 94% of deaths had a an average of 2.6 comorbidities according to some studies. And if there was a worldwide pandemic as we are programmed to believe by the mainstream media, why are 2020 deaths lower in every week of 2020 than in 2019 except the first 2 weeks of January before the China virus arrived? In fact, CDC data, according to a mid-August report (now redacted but used the CDC’s own week-by-week death numbers) by Dr. Colleen Huber at PrimaryDoctor.org, 2020 has the lowest weekly death rate in a decade  – so far, and the 2nd lowest annual US deaths in the last 21 years.

How Forced Isolation Makes Huge Power Grabs Possible

So, why then are we being forced to social distance, or even wear masks when the imaginary, unproven virus

Stella Morabito explains in an article on The Federalist that today’s wannabe social controllers are clearly using the virus as a sort of obedience school where we can be conditioned through isolation to conform to their demands.

She begins her excellent article with this quote:

“Terror can rule absolutely only over men who are isolated against each other… Therefore, one of the primary concerns of all tyrannical government is to bring this isolation about.” — Hannah Arendt, The Origins of Totalitarianism

She then wisely points out:

Pick a dictator, any dictator—Joseph Stalin, Adolf Hitler, Mao Zedong, Jim Jones (dictator of his own realm)—and you’ll find a common pattern of imposing aloneness and the terror of it on their prey. You can probably name more examples from the world stage as well as from smaller domains. They may vary in their methods and territories, but all use social pressure to live out the ancient principle of divide-and-conquer. As political philosopher Hannah Arendt noted, totalitarians must first get people isolated against one other in order to rule over them.

Tactics for grabbing power always involve some form of imposed isolation through social pressures: mob swarming, forced false confessions; struggle sessions; hostility towards family, religion, and history; snitch culture; censorship; constant propaganda; and more. “Cancel culture” is just a new term for an old custom of tyrants who use social pressures to go after the raw power they crave. Former New York Times columnist Bari Weiss aptly described cancel culture as social murder.

So what is America to do?

We Need to Build Immunity Against Social Pressure, Stella proposes:

Imposed social isolation is unnatural for human beings. It’s torture that makes us highly vulnerable to any social pressures that suggest some relief from it. Whatever their motives, today’s wannabe social controllers are clearly using the virus as a sort of obedience school where we can be conditioned through isolation to conform to their demands.

Many likely comply in hopes of being rewarded—maybe we’ll get to go for a walk someday if we’re good dogs. The irony is that mindless conformity creates even more isolation and even more vulnerability, even as we believe we’re escaping it through compliance.

But what if enough good people were immune to social pressure? Or resistant enough to it that they spread some immunity to others? Well, then, our power-mongering elites would be disarmed. Game over.

In this light, here’s a fascinating question to ponder: What exactly do they hate most about President Trump? Doubtless they hate him mostly because he seems immune to their social pressures.

That’s the bottom line. They can’t control him the way they do other Republican leaders who are so fearful of being called mean names. Worse for these power elites is that they can’t seem to isolate Trump’s supporters from him.

No matter what you think of Trump or his tweets, we should all meditate on the power of that sort of immunity from social pressures. We should find ways to develop it in ourselves. Because if tyrants had less ability to instill social isolation, they’d be less able to induce the fears that allow them to control people’s lives.

In other words, it starts with YOU, and me, and spreads.

Source: ConservativeDailyNews reporting on this TheFederalist article

A number of police departments around the country used drones manufactured by a company with ties to the Chinese government in order to enforce COVID-19-related lockdowns, prompting concerns from experts who say the drones may serve as a way for the east Asian communist regime to spy on the United States. “Should people be concerned? Yes. Everyone should always be concerned,” says Brett Velicovich, former Army intelligence worker and author of the book Drone Warrior. While DIJ denies it has any motives beyond altruism in its donation of drone technology to U.S. law-enforcement agencies, many — from lawmakers to watchdog groups to drone experts — say America’s reliance on Chinese technology to monitor its own citizens could lead to disastrous national security consequences.

After demonizing protestors anxious to get back to work, end tyrannical lockdown policing by dictator governors, mayors, etc, suddenly protests were praised and social distancing forgotten when it was politically convenient following the George Floyd Riots sponsored by George Soros and other democrats to flame the race war. (See video below by Laura Ingraham…)

9-1-1 lines became flooded with calls from people concerned that someone wasn’t following social distancing protocol.

The term was mentioned in a movie about a virus pandemic called “Contagion” (2011). In the scene, Laurence Fishburne’s character, who plays a CDC medical doctor, advises, “Our best defense has been social distancing… staying home when you’re sick, washing your hands frequently.

The first time it appeared in the New York Times was February 12, 2006:

If the avian flu goes pandemic while Tamiflu and vaccines are still in short supply, experts say, the only protection most Americans will have is “social distancing,” which is the new politically correct way of saying “quarantine.”

But distancing also encompasses less drastic measures, like wearing face masks, staying out of elevators — and the [elbow] bump. Such stratagems, those experts say, will rewrite the ways we interact, at least during the weeks when the waves of influenza are washing over us.

The New York Times (April 22, 2020) tells the story of how George Bush, in 2006 during the H5N1 avian flu pandemic that resulted in very few deaths, asked experts to submit plans on how to best deal with the next pandemic. Drs. Hatchett and Mecher proposed that Americans in some places might have to self-isolate.

“That this idea became the heart of the national playbook for responding to a pandemic is one of the untold stories of the coronavirus crisis. It required the key proponents — Dr. Mecher, a Department of Veterans Affairs physician, and Dr. Hatchett, an oncologist turned White House adviser — to overcome intense initial opposition.

The concept of social distancing is now intimately familiar to almost everyone. But as it first made its way through the federal bureaucracy in 2006 and 2007, it was viewed as impractical, unnecessary and politically infeasible.”

In the course of this planning, neither legal nor economic experts were brought in to consult and advise. Instead it fell to Mecher (formerly of Chicago and an intensive care doctor with no previous expertise in pandemics) and the oncologist Hatchett.

The article also mentions the 14-yr.-old daughter of a scientist at the Sandia National Laboratories, Laura M. Glass, who declined to be interviewed when the Albuquerque Journal did a deep dive of this history.

Laura, with some guidance from her dad, devised a computer simulation that showed how people – family members, co-workers, students in schools, people in social situations – interact. What she discovered was that school kids come in contact with about 140 people a day, more than any other group. Based on that finding, her program showed that in a hypothetical town of 10,000 people, 5,000 would be infected during a pandemic if no measures were taken, but only 500 would be infected if the schools were closed.

Laura’s name appears on the foundational paper arguing for lockdowns and forced human separation. That paper is Targeted Social Distancing Designs for Pandemic Influenza (2006). It set out a model for forced separation and applied it with good results backwards in time to 1957. They conclude with a chilling call for what amounts to a totalitarian lockdown, all stated very matter-of-factly.

Implementation of social distancing strategies is challenging. They likely must be imposed for the duration of the local epidemic and possibly until a strain-specific vaccine is developed and distributed. If compliance with the strategy is high over this period, an epidemic within a community can be averted. However, if neighboring communities do not also use these interventions, infected neighbors will continue to introduce influenza and prolong the local epidemic, albeit at a depressed level more easily accommodated by healthcare systems.

In other words, it was a high-school science experiment that eventually became law of the land, and through a circuitous route propelled not by science but politics.  The primary author of this paper was Robert J. Glass, a complex-systems analyst with Sandia National Laboratories. He had no medical training, much less an expertise in immunology or epidemiology. That explains why Dr. D.A. Henderson, “who had been the leader of the international effort to eradicate smallpox,” completely rejected the whole scheme.1

There’s a reason that “social distancing” wasn’t a buzzword common to the American lexicon prior to 2020.  There’s very little science behind “social distancing” at all.

“It turns out,” Julie Kelly writes at American Greatness, “as I wrote last month, “social distancing” is untested pseudoscience particularly as it relates to halting the transmission of the SARS-CoV-2 virus. On its website, the CDC provides no links to any peer-reviewed social distancing studies that bolster its official guidance.” 

There’s a reason for the lack of peer-reviewed studies on the CDC website.  She continues:

The alarming reality is that social distancing never has been tested on a massive scale in the modern age; its current formula was conceived during George W. Bush’s administration and met with much-deserved skepticism.

“People could not believe that the strategy would be effective or even feasible,” one scientist told the New York Times last month. A high school science project—no, I am not joking—added more weight to the concept.

“Social distancing” is very much a newfangled experiment, not settled science.  And, Kelley writes, the results are suggesting that our “Great Social Distancing Experiment of 2020” will be “near the top of the list” of “bad experiments gone horribly wrong.”

You also don’t have to be a scientist to also instinctively know that “two weeks to flatten the curve” becoming “America must lock down until a vaccine is created” is more social experimentation than science.  But what the data have fleshed out, beyond the point of argument, is that the proximity of one human being to another has proven to be a very small factor in determining the impact of Covid-19 infections. What’s far more important is which human beings happen to be in close proximity of one another.

According to Dr. Steven Shapiro and the University of Pittsburgh Medical Center:

Crowded indoor conditions can be devastating in nursing homes, while on the USS Theodore Roosevelt 1,102 sailors were infected, but only 7 required hospitalization, with 1 death. This contrast has significant implications that we have not embraced. Epidemiologic prediction models have performed poorly, often neglecting critical variables.

Governor Andrew Cuomo of New York said that it’s “shocking” to discover that 66 percent of new hospitalizations appear to have been among people “largely sheltering at home.” 

“We thought maybe they were taking public transportation, but actually no, because these people were literally at home.”

“Much of this comes down to what you do to protect yourself,” he continues.  “Everything closed down, government has done everything it could, society has done everything it could.”

It’s your fault, he says to the hospitalized New Yorkers who loyally complied with his government directive.  But here’s an interesting alternative theory as to why, mostly, old people who are staying at home are being hospitalized.

The USS Theodore Roosevelt had a crew of 4,800.  Given the acute sample, testing was holistic.  This yields an actual infection rate of roughly 23 percent, and among those infected, the fatality rate is 0.09 percent.  Among the Roosevelt’s entire crew of assumedly healthy and able-bodied sailors, on a floating Petri dish, during the thick of viral outbreak that shut down all schools and placed healthy citizens across America under house-arrest, the fatality rate was .002 percent.

It seems more than obvious that there is little sense in quarantining the young and healthy.  As Dr. Shapiro also observes:

Our outcomes are similar to the state of Pennsylvania, where the median age of death from COVID-19 is 84 years old.  The few younger patients who died all had significant preexisting conditions.  Very few children were infected and none died.  Minorities in our communities fared equally well as others, but we know that this is not the case nationally.  In sum, this is a disease of the elderly, sick, and poor.

Here’s another thing you likely already know.  Politicians and the media are committing to damage control to hide all of these facts from you.  In fact, finding any news relating to Dr. Shapiro’s somewhat revelatory comments online is, so far, quite difficult.

That’s because, for the people who pushed “social distancing” and destroying the economy as an absolutely necessary evil, this is a matter of self-preservation.  If this information were widely known, citizens might be more inclined to demand that schools and parks and restaurants and malls be opened.  But if schools had reopened immediately, without testing, and there was not a surge in hospitalizations or deaths, then the obvious question is why the schools closed in the first place.  If restaurants and other shuttered businesses open without a spike in hospitalizations and deaths, then why did they ever close?

There’s value in the media and government officials maintaining the public perception that the costs of “social distancing” have been offset by its benefits.  But while those benefits are elusive in the data, and require mountains of presumption to imagine that they even exist at all, the costs of “social distancing” couldn’t be clearer.

As Dr. Steven Shapiro concludes:

What we cannot do, is extended social isolation. Humans are social beings, and we are already seeing the adverse mental health consequences of loneliness, and that is before the much greater effects of economic devastation take hold on the human condition…

In this particular case, the problem we’re not going to be able to fix in the short term is the complete eradication of the virus. The problem we can fix is to serve and protect our seniors, especially those in nursing homes. If we do that, we can reopen society, and though infectious cases may rise as in the Theodore Roosevelt, the death rate will not, providing time for the development of treatments and vaccines.

An international research team led by Erin Schuman from the Max Planck Institute for Brain Research discovered a brain molecule that functions as a “thermometer” for the presence of others in an animal’s environment. Zebrafish “feel” the presence of others via mechanosensation and water movements—which turns the brain hormone on. The scientists used RNA sequencing to measure the expression levels of thousands of neuronal genes.

They “found a consistent change in expression for a handful of genes in fish that were raised in . One of them was parathyroid hormone 2 (pth2), coding for a relatively unknown peptide in the brain. Curiously, pth2 expression tracked not just the presence of others, but also their density. Surprisingly, when zebrafish were isolated, pth2 disappeared in the brain, but its  rapidly rose, like a thermometer reading, when other fish were added to the tank,” explains Anneser.”

Thrilled by this discovery, the scientists tested if the effects of isolation could be reversed by putting the previously isolated fish into a social setting. “After just 30 minutes swimming with their kin, there was a significant recovery of the pth2 levels. After 12 hours with kin the pth2 levels were indistinguishable from those seen in socially-raised animals,” says Anneser. “This really strong and fast regulation was unexpected and indicated a very tight link between gene expression and the environment.”3

At this point, this is little more than common sense, and the truth can’t continue to be suppressed for much longer.  It’s becoming more and more obvious that it’s well past time to take a more tactical approach to mitigation, as Dr. Katz suggested back on March 20, allocating resources and efforts toward protecting and caring for those most at-risk, and ending this soul-crushing and economy-crashing experiment with holistic “social distancing.”2

Even into mid-June and July, leftist politicians were clinging to social distancing. Writing for The Telegraph, Professors Carl Heneghan and Tom Jefferson, from the University of Oxford, said there is little evidence to support the restriction and called for an end to the “formalised rules”. The University of Dundee also said there was no indication that distancing at two metres (6 ft.) is safer than one metre.

Examining the current evidence for the two-metre rule, Prof Heneghan and Prof Jefferson looked at 172 studies cited in a recent review in The Lancet and found just five had dealt explicitly with coronavirus infection in relation to distance. Only one mentioned coming within six feet of a patient, and that paper showed proximity had no impact. Read full story here…

Professor Robert Dingwall, a sociologist at Nottingham Trent University and a member of government advisory group NERVTAG (New and Emerging Respiratory Virus Threats Advisory Group), said the 2 meter distance was unnecessary. “The distance may be a non-scientific estimate that just caught on in countries around the world, as top researchers say there is not solid evidence to back it up,” reports the Daily Mail. Former Conservative Party Cabinet minister Iain Duncan-Smith also warned that the 2 meter rule could cripple the hospitality sector.

What if the government directive to close everything down and mandate “social distancing” actually made the problem worse?

Dr. David Katz predicted precisely this outcome on March 20, in an article that is proving every bit as correct in its predictions and sober policy recommendations as Dr. Anthony Fauci has been proven incorrect — which is another way of saying that the article has proven flawless, so far. Dr. Katz writes:

[I]n more and more places we are limiting gatherings uniformly, a tactic I call “horizontal interdiction” — when containment policies are applied to the entire population without consideration of their risk for severe infection.

But as the work force is laid off en masse (our family has one adult child home for that reason already), and colleges close (we have another two young adults back home for this reason), young people of indeterminate infectious status are being sent home to huddle with their families nationwide. And because we lack widespread testing, they may be carrying the virus and transmitting it to their 50-something parents, and 70- or 80-something grandparents. If there are any clear guidelines for behavior within families — what I call “vertical interdiction” — I have not seen them.

One might be inclined to simply accept this as an unintended consequence of “social distancing,” but accepting that would require there to be some kind of benefit to “social distancing” that would make it worth the cost. 

Is there?

Very likely, you already instinctively know that the guidelines suggesting that it’s somehow helpful to keep a six-foot space between healthy people, even outdoors, is not based on science, but just an arbitrary suggestion we’ve been conditioned to accept without evidence.

As social distancing was pushed as the ‘new normal’, businesses and gyms came up with ways (signs, distancing tables, even hats, etc.) to enforce the unscientific method, while some cities used draconian measures to enforce distancing such as one-way sidewalks.3

Just as 9/11 greatly altered our society on a permanent basis, many of our social engineers intend to make “social distancing” a permanent part of our lives.  If they have their way, there will be written or unwritten rules about how close you can get to other people virtually everywhere that you go. Can you imagine a world where you have to constantly be concerned about walking, standing or sitting too close to someone else?

Hong Kong, Thailand, Israel, and the US tried to track and monitor “patients” under house arrest that have tested positive for COVID-19, scrape travel history, and spy on your violations of gathering and even being closer to others than their “social distancing” mandates. The plan was to label violators of social distancing as terrorists, but the plan may have been foiled by many who were supposed to be enforcing the draconian measures but were caught violating their own rules such as CNN’s Chris Cuomo and Gretchen Whitmer, Governor of Michigan.

And then there’s contact tracing where they will track your every move to see if you came into contact with someone with the virus, but it’s for your own good! Read the CDC guidelines on contact tracing. Read HR 6666 and the new Hero Bill. Try to figure out EXACTLY how the tracing program works. Count how many holes there are in the Swiss Cheese. The bottom line is: they’ll do what they can get away with. They’ll make up reasons for doing it. Contact tracing is just the forward edge of a MUCH larger program of surveillance.

Sources:

  1. https://www.aier.org/article/the-2006-origins-of-the-lockdown-idea/
  2. ZeroHedge
  3. Infowars

The video below by Paul Joseph Watson brilliantly highlights the “new normal” insanity of social distancing that is creating a society so pedantic and cringeworthy, it’s almost like it’s a tactic to make us want to stay indoors forever. (Warning for some offensive language)